anti upf1 (Novus Biologicals)
Novus Biologicals is a verified supplier 
Novus Biologicals manufactures this product 
93
Structured Review
Novus Biologicals
anti upf1
Anti Upf1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pmc11233602__41467_2024_50032_MOESM7_ESM-54-54-55
Average 93 stars, based on 2 article reviews
Anti Upf1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/NBP1-05967/RENT1%2FUPF1%2FhUPF1+Antibody/pmc11233602__41467_2024_50032_MOESM7_ESM-54-54-55
Average 93 stars, based on 2 article reviews
anti upf1 - by Bioz Stars,
2026-11
93/100 stars
Images
Related Articles
Chromatin Immunoprecipitation:Article Title: Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Primary antibodies for immunoblot analysis used in this study were as follows: Flow Cytometry:Article Title: Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Primary antibodies for immunoblot analysis used in this study were as follows: Article Title: Analysis and generation of B cell specific Upf1 deficient mice Enrichment score plot of down-regulated genes in Upf1-deficient early LPre-B cells Loss of IFNαR1 signaling does not impact B cell development. Genetic pre-arrangement of Igh locus rescued early to late LPre B cell differentiation in Upf1-cKO mice Genetic pre-arrangement of Igh locus did not rescue the splenic B cell population in Upf1-cKO mice Transcriptome analysis of Upf1-cKO/IghB1-8hi early LPre- and sPre-B cells Identifying UPF1-target RNAs Article Snippet: .. Genotyping for Upf1-Flox forward GAATTGGTGGCATGGGTCCCATATCCCAG Genotyping for Upf1-Flox reverse GACTCTTCCTGGCCTTGAGCCTGGATG VHJ558 forward CGAGCTCTCCARCACAGCCTWCATGCARCTCARC VH7183 forward CGGTACCAAGAASAMCCTGTWCCTGCAAATGASC DH forward TTCAAAGCACAATGCCTGGCT JH3 reverse GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG Cμ forward TGGCCATGGGCTGCCTAGCCCGGGACTT Cμ reverse GCCTGACTGAGCTCACACAAGGAGGA Vk forward GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC Jk reverse CTCATTCCTGTTGAAGCTCTTGACAATGGG Supplementary Table 1 List of primers used for PCR Supplementary Table 3 List of primers used for RT-qPCR Forward Reverse 18S rRNA CGGACAGGATTGACAGATTG CAAATCGCTCCACCAAGTAA mouse Upf1 GCTGAACTTCGAGGAAGATG CTTCCTTGCATTTTGCCCTC mouse Gas5 CAGGTATTAATGGGTCACCTC CTTCTATTTGAGCCTCCATCC mouse Mx1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC mouse Mx2 TTCACCAGGCTCCGAAAAGAG ACAAACCCTGGCAATTCTCG Antibody Cat# Company Clone Application Dilution Magnetic Resonance Imaging:Article Title: Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Primary antibodies for immunoblot analysis used in this study were as follows: Western Blot:Article Title: Article Snippet: .. Materials & experimental systems n/a Involved in the study Antibodies Eukaryotic cell lines Palaeontology and archaeology Animals and other organisms Clinical data Dual use research of concern Plants Methods n/a Involved in the study ChIP-seq Flow cytometry MRI-based neuroimaging Antibodies Antibodies used Primary antibodies for immunoblot analysis used in this study were as follows: Article Title: UPF1 plays critical roles in early B cell development. Article Snippet: Membranes were incubated with indicated primary antibodies and HRP-coupled secondary antibodies (NA9340; GE Healthcare). .. The following primary antibodies were used for immunoblot analysis: Article Title: Analysis and generation of B cell specific Upf1 deficient mice Enrichment score plot of down-regulated genes in Upf1-deficient early LPre-B cells Loss of IFNαR1 signaling does not impact B cell development. Genetic pre-arrangement of Igh locus rescued early to late LPre B cell differentiation in Upf1-cKO mice Genetic pre-arrangement of Igh locus did not rescue the splenic B cell population in Upf1-cKO mice Transcriptome analysis of Upf1-cKO/IghB1-8hi early LPre- and sPre-B cells Identifying UPF1-target RNAs Article Snippet: .. Genotyping for Upf1-Flox forward GAATTGGTGGCATGGGTCCCATATCCCAG Genotyping for Upf1-Flox reverse GACTCTTCCTGGCCTTGAGCCTGGATG VHJ558 forward CGAGCTCTCCARCACAGCCTWCATGCARCTCARC VH7183 forward CGGTACCAAGAASAMCCTGTWCCTGCAAATGASC DH forward TTCAAAGCACAATGCCTGGCT JH3 reverse GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG Cμ forward TGGCCATGGGCTGCCTAGCCCGGGACTT Cμ reverse GCCTGACTGAGCTCACACAAGGAGGA Vk forward GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC Jk reverse CTCATTCCTGTTGAAGCTCTTGACAATGGG Supplementary Table 1 List of primers used for PCR Supplementary Table 3 List of primers used for RT-qPCR Forward Reverse 18S rRNA CGGACAGGATTGACAGATTG CAAATCGCTCCACCAAGTAA mouse Upf1 GCTGAACTTCGAGGAAGATG CTTCCTTGCATTTTGCCCTC mouse Gas5 CAGGTATTAATGGGTCACCTC CTTCTATTTGAGCCTCCATCC mouse Mx1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC mouse Mx2 TTCACCAGGCTCCGAAAAGAG ACAAACCCTGGCAATTCTCG Antibody Cat# Company Clone Application Dilution Polymerase Chain Reaction:Article Title: Analysis and generation of B cell specific Upf1 deficient mice Enrichment score plot of down-regulated genes in Upf1-deficient early LPre-B cells Loss of IFNαR1 signaling does not impact B cell development. Genetic pre-arrangement of Igh locus rescued early to late LPre B cell differentiation in Upf1-cKO mice Genetic pre-arrangement of Igh locus did not rescue the splenic B cell population in Upf1-cKO mice Transcriptome analysis of Upf1-cKO/IghB1-8hi early LPre- and sPre-B cells Identifying UPF1-target RNAs Article Snippet: .. Genotyping for Upf1-Flox forward GAATTGGTGGCATGGGTCCCATATCCCAG Genotyping for Upf1-Flox reverse GACTCTTCCTGGCCTTGAGCCTGGATG VHJ558 forward CGAGCTCTCCARCACAGCCTWCATGCARCTCARC VH7183 forward CGGTACCAAGAASAMCCTGTWCCTGCAAATGASC DH forward TTCAAAGCACAATGCCTGGCT JH3 reverse GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG Cμ forward TGGCCATGGGCTGCCTAGCCCGGGACTT Cμ reverse GCCTGACTGAGCTCACACAAGGAGGA Vk forward GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC Jk reverse CTCATTCCTGTTGAAGCTCTTGACAATGGG Supplementary Table 1 List of primers used for PCR Supplementary Table 3 List of primers used for RT-qPCR Forward Reverse 18S rRNA CGGACAGGATTGACAGATTG CAAATCGCTCCACCAAGTAA mouse Upf1 GCTGAACTTCGAGGAAGATG CTTCCTTGCATTTTGCCCTC mouse Gas5 CAGGTATTAATGGGTCACCTC CTTCTATTTGAGCCTCCATCC mouse Mx1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC mouse Mx2 TTCACCAGGCTCCGAAAAGAG ACAAACCCTGGCAATTCTCG Antibody Cat# Company Clone Application Dilution Quantitative RT-PCR:Article Title: Analysis and generation of B cell specific Upf1 deficient mice Enrichment score plot of down-regulated genes in Upf1-deficient early LPre-B cells Loss of IFNαR1 signaling does not impact B cell development. Genetic pre-arrangement of Igh locus rescued early to late LPre B cell differentiation in Upf1-cKO mice Genetic pre-arrangement of Igh locus did not rescue the splenic B cell population in Upf1-cKO mice Transcriptome analysis of Upf1-cKO/IghB1-8hi early LPre- and sPre-B cells Identifying UPF1-target RNAs Article Snippet: .. Genotyping for Upf1-Flox forward GAATTGGTGGCATGGGTCCCATATCCCAG Genotyping for Upf1-Flox reverse GACTCTTCCTGGCCTTGAGCCTGGATG VHJ558 forward CGAGCTCTCCARCACAGCCTWCATGCARCTCARC VH7183 forward CGGTACCAAGAASAMCCTGTWCCTGCAAATGASC DH forward TTCAAAGCACAATGCCTGGCT JH3 reverse GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG Cμ forward TGGCCATGGGCTGCCTAGCCCGGGACTT Cμ reverse GCCTGACTGAGCTCACACAAGGAGGA Vk forward GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC Jk reverse CTCATTCCTGTTGAAGCTCTTGACAATGGG Supplementary Table 1 List of primers used for PCR Supplementary Table 3 List of primers used for RT-qPCR Forward Reverse 18S rRNA CGGACAGGATTGACAGATTG CAAATCGCTCCACCAAGTAA mouse Upf1 GCTGAACTTCGAGGAAGATG CTTCCTTGCATTTTGCCCTC mouse Gas5 CAGGTATTAATGGGTCACCTC CTTCTATTTGAGCCTCCATCC mouse Mx1 GATCCGACTTCACTTCCAGATGG CATCTCAGTGGTAGTCAACCC mouse Mx2 TTCACCAGGCTCCGAAAAGAG ACAAACCCTGGCAATTCTCG Antibody Cat# Company Clone Application Dilution other:Article Title: Table 4 Article Snippet: Anti‐FLAG , N‐terminal DYKDDDDK‐tagged ECD of |
